about people participation resources data links
Gene Name Sequence Direction Details
nucssu BMB-A GWATTACCGCGGCKGCTG reverse details
nucssu BMB-B CCGTCAATTCMTTTRAGTTT reverse details
nucssu BMB-C ACGGGCGGTGTGTRC reverse details
nucssu BMB-BR CTTAAAGGAATTGACGGAA forward details
nucssu BMB-CR GTACACACCGCCCGTCG forward details
nucssu NS1 GTAGTCATATGCTTGTCTC forward details
nucssu NS2 GGCTGCTGGCACCAGACTTGC reverse details
nucssu NS3 GCAAGTCTGGTGCCAGCAGCC forward details
nucssu NS4 CTTCCGTCAATTCCTTTAAG reverse details
nucssu NS5 AACTTAAAGGAATTGACGGAAG forward details
nucssu NS6 GCATCACAGACCTGTTATTGCCTC reverse details
nucssu NS7 GAGGCAATAACAGGTCTGTGATGC forward details
nucssu NS8 TCCGCAGGTTCACCTACGGA reverse details
nucssu NS17 CATGTCTAAGTTTAAGCAA forward details
nucssu NS18 CTCATTCCAATTACAAGACC reverse details
nucssu NS19 CCGGAGAAGGAGCCTGAGAAAC forward details
nucssu NS20 CGTCCCTATTAATCATTACG reverse details
nucssu NS21 GAATAATAGAATAGGACG forward details
nucssu NS22 AATTAAGCAGACAAATCACT reverse details
nucssu NS23 GACTCAACACGGGGAAACTC forward details
nucssu NS24 AAACCTTGTTACGACTTTTA reverse details
nucssu SR1 ATTACCGCGGCTGCT reverse details
nucssu SR1R TACCTGGTTGATTCTGC forward details
nucssu SR2 CGGCCATGCACCACC reverse details
nucssu SR3 GAAAGTTGATAGGGCT reverse details
nucssu SR4 AAACCAACAAAATAGAA reverse details
nucssu SR5 GTGCCCTTCCGTCAATT reverse details
nucssu SR6 TGTTACGACTTTTACTT reverse details
nucssu SR7 GTTCAACTACGAGCTTTTTAA reverse details
nucssu SR7R TTAAAAAGCTCGTAGTTGAAC forward details
nucssu SR8R GAACCAGGACTTTTACCTT forward details
nucssu SR9R YAGAGGTGAAATTCT forward details
nucssu SR10R TTTGACTCAACACGGG forward details
nucssu SR11R GGAGCCTGAGAAACGGCTAC forward details
nucssu SR11 GTAGCCGTTTCTCAGGCTCC reverse details
nucssu 1 GCTCTTTCTTGATTTTGT forward details
nucssu 3 TTTGAGGCAATAACAGGT forward details
nucssu 4 CATCTAAGGGCATCACAG reverse details
nucssu 5 TTGTCTCTGTCAGTGTAG reverse details
nucssu 6 CAACGAGGAATTCCTAGT forward details
nucssu 9 AATGATCCTTCCGCAGGT reverse details
nucssu nssu131 CAGTTATCGTTTATTTGATAGTACC forward details
nucssu nssu131R GGTACTATCAAATAAACGATAACTG reverse details
nucssu nssu97b CGGTGAAACTGCGAATGGC forward details
nucssu nssu97a TATACGGTGAAACTGCGAATGGC forward details
nucssu nssu634 CCCCAGAAGGAAAGICCCGICC reverse details
nucssu nssu897R AGAGGTGAAATTCTTGGA forward details
nucssu nssu1088 TGATTTCTCGTAAGGTGCCG reverse details
nucssu nssu1088R CGGCACCTTACGAGAAATCA forward details
nuclsu GUADET_P1 GAGTCGAGTTGTTTGGGAATGCAGC forward details
nuclsu GUADET_P2 GAAAAGAACTTTGAAAAGAGAGTGAA forward details
nuclsu GUADET_P3 CCCGTCTTGAAACACGGACCAAGG forward details
nuclsu P2R CTCTCTTTTCAAAGTTCTTTTCATCT reverse details
nuclsu LR0R2 ACCCGCTGAACTTAAGC forward details
nuclsu LR0R GTACCCGCTGAACTTAAGC forward details
nuclsu LR1R AGGAAAAGAAACCAACC forward details
nuclsu LR2 TTTTCAAAGTTCTTTTC reverse details
nuclsu LR2R AAGAACTTTGAAAAGAG forward details
nuclsu LR3 GGTCCGTGTTTCAAGAC reverse details
nuclsu LR3R GTCTTGAAACACGGACC forward details
nuclsu LR4 ACCAGAGTTTCCTCTGG reverse details
nuclsu LR5 ATCCTGAGGGAAACTTC reverse details
nuclsu LR5R GAAGTTTCCCTCAGGAT forward details
nuclsu LR6 CGCCAGTTCTGCTTACC reverse details
nuclsu LR6R GGTAAGCAGAACTGGCG forward details
nuclsu LR7 TACTACCACCAAGATCT reverse details
nuclsu LR7R AGATCTTGGTGGTAGTA forward details
nuclsu LR8 CACCTTGGAGACCTGCT reverse details
nuclsu LR8R AGCAGGTCTCCAAGGTG forward details
nuclsu LR9 AGAGCACTGGGCAGAAA reverse details
nuclsu LR10 AGTCAAGCTCAACAGGG reverse details
nuclsu LR10R GACCCTGTTGAGCTTGA forward details
nuclsu LR11 GCCAGTTATCCCTGTGGTAA reverse details
nuclsu LR12 GACTTAGAGGCGTTCAG reverse details
nuclsu LR12R CTGAACGCCTCTAAGTCAGAA forward details
nuclsu LR13 CATCGGAACAACAATGC reverse details
nuclsu LR14 AGCCAAACTCCCCACCTG reverse details
nuclsu LR15 TAAATTACAACTCGGAC reverse details
nuclsu LR16 TTCCACCCAAACACTCG reverse details
nuclsu LR17R TAACCTATTCTCAAACTT forward details
nuclsu LR20R GTGAGACAGGTTAGTTTTACCCT forward details
nuclsu LR21 ACTTCAAGCGTTTCCCTTT reverse details
nuclsu LR22 CCTCACGGTACTTGTTCGCT reverse details
nuclsu F377 AGATGAAAAGAACTTTGAAAAGAGAA forward details
nuclsu R377 CTCTCTTTTCAAAGTTCTTTTCATCT reverse details
nuclsu LIC15R GGAGGAAAAGAAACCAACAG forward details
nuclsu LIC24R GAAACCAACAGGGATTG forward details
nuclsu LIC52R GGCGAGTGAAGCGGCAACAGCT forward details
nuclsu LIC1460R CTAGTGCAGATCTTGGTG forward details
nuclsu LIC1569 TTAGGATCGACTAACCC reverse details
nuclsu LIC2044 ACGCCTGCCTACTCGCC reverse details
nuclsu LIC2028 CGCCAGGGCATCGTTCCTA reverse details
nuclsu LIC2187R AAGGGGAATCTGACTGTC forward details
nuclsu LIC2197 ATTCCCCTTGTCCGTACC reverse details
nuclsu LIC2387R TAACGAGATTCCCACTG forward details
nuclsu LIC2830R CCTATCGATCCTTTAGTC forward details
nuclsu LIC2927 GTCGCTATGAACGCTTGG reverse details
nucits ITS1 TCCGTAGGTGAACCTGCGG forward details
nucits ITS1F CTTGGTCATTTAGAGGAAGTAA forward details
nucits ITS2 GCTGCGTTCTTCATCGATGC reverse details
nucits ITS3 GCATCGATGAAGAACGCAGC forward details
nucits ITS4 TCCTCCGCTTATTGATATGC reverse details
nucits ITS4B CAGGAGACTTGTACACGGTCCAG reverse details
nucits ITS4S CCTCCGCTTATTGATATGCTTAAG reverse details
nucits ITS5 GGAAGTAAAAGTCGTAACAAGG forward details
nucits ITS5R CCTTGTTACGACTTTTACTTCC reverse details
nucits 5_8S CGCTGCGTTCTTCATCG reverse details
nucits 5_8SR TCGATGAAGAACGCAGC forward details
nucits SR6R AAGTAPAAGTCGTAACAAGG forward details
nucits LR1 GGTTGGTTTCTTTTCCT reverse details
nucits SLG-1 TTGCGCAACCTGCGGAAGGAT forward details
nucits NS24R TAAAAGTCGTAACAAGGTTT forward details
nucssu NS1_5 AAGGCAGCAGGCGCGCAAATTAC forward details
nucits ITS4NA CTTTCATCTTTCCCTCACGG reverse details
ef1a 2218R ATGACACCRACRGCRACRGTYTG reverse details
ef1a 983 GCYCCYGGHCAYCGTGAYTTYAT forward details
ef1a 1567R ACHGTRCCRATACCACCRATCTT reverse details
ef1a 526 GTCGTYGTYATYGGHCAYGT forward details
ef1a 1577 CARGAYGTBTACAAGATYGGTGG forward details
nucits ITS1-CS CAGGTGTTTCACTGCTGCTC forward details
nucits ITS4-CS TTTCCTTTTCATTCGCCATT reverse details
nuclsu LR8_5 TTNTTCTATCAACTAGAGGCT reverse details
nucits ITS1-EM TGGTAGAGAATGATGGCTGTTG forward details
nucits ITS4-EM GCCTCTATGCCTAATTGCCTTT reverse details
nuclsu LR11-CR CCGGATTGTTACCAGCATTT reverse details
nuclsu LR9R-CR CTGCAGTTAACGACCAGCTT forward details
nuclsu LR6_5R CTGCAGTTAACGACCAGCTT forward details
nuclsu LR7-CR ACGATCCAAGCGCAGGAA reverse details
nuclsu Cor3 GAAACACGGACCAGGAG forward details
nuclsu Ram1 NNNNNNNNNNN forward details
ef1a EF1a1F TACAARTGYGGTGGTATYGACA forward details
ef1a EF1a1R ACNGACTTGACYTCAGTRGT reverse details
mitssu MS1 CAGCAGTCAAGAATATTAGTCAATG forward details
mitssu MS2 GCGGATTATCGAATTAAATAAC reverse details
ef1a EF1a2F TCNTTCAARTAYGCNTGGGT forward details
ef1a Efgr GCAATGTGGGCRGTRTGRCARTC reverse details
atp6 ATPC1A AGAWCAATTYGAARTRAGAG forward details
atp6 ATPC2A ACAAAYACTTGWGCTTGKATWAAIGC reverse details
ef1a EF1a3R GARACGTTCTTNACGTTGAA reverse details
rpb2 RPB2-3bF GGWGGWTAYTTYATYATYAATGG forward details
rpb2 fRPB2-5F GAYGAYMGWGATCAYTTYGG forward details
rpb2 fRPB2-5R CCRAARTGATCWCKRTCRTC reverse details
rpb2 RPB2-6F TGGGGKWTGGTYTGYCCTGC forward details
rpb2 RPB2-6R GCAGGRCARACCAWMCCCCA reverse details
rpb2 RPB2-7F ATGGGKAAGCARGCWATGGG forward details
rpb2 RPB2-7R CCCATWGCYTGCTTMCCCAT reverse details
rpb2 fRPB2-7cF ATGGGYAARCAAGCYATGGG forward details
rpb2 fRPB2-7cR CCCATRGCTTGYTTRCCCAT reverse details
rpb2 RPB2-11aR GTGWATYTTRTCRTCMACC reverse details
rpb2 RPB2-11bR CAATCWCGYTCCATYTCWCC reverse details
rpb2 fRPB2-11aR GCRTGGATCTTRTCRTCSACC reverse details
rpb1 RPB1-Ac GARTGYCCDGGDCAYTTYGG forward details
rpb1 RPB1-Cr CCNGCDATNTCRTTRTCCATRTA reverse details
rpb1 RPB1-Df TACAATGCYGAYTTYGAYGG forward details
rpb1 RPB1-Dr TTCATYTCRTCDCCRTCRAARTC reverse details
rpb1 RPB1-Fr CCYTCNCKWCCWCCCATDGCRTG reverse details
nuclsu COR4 GGTAAGCAGAACTGGCG forward details
mitssu mrSSU1 AGCAGTGAGGAATATTGGTC forward details
mitssu mrSSU2 CTGACGTTGAAGGACGAAGG forward details
mitssu mrSSU2R CCTTCGTCCTTCAACGTCAG reverse details
mitssu mrSSU3R ATGTGGCACGTCTATAGCCC reverse details
ef1a eM13F GTAAAACGACGGCCAG forward details
ef1a eM13R CAGGAAACAGCTATGAC reverse details
atp6 ATP6-3 TCTCCTTTAGAACAATTTGA forward details
atp6 ATP6-2 TAATTCTANWGCATCTTTAATRTA reverse details
ef1a 1567Rb ACHGTRCCRATACCACCRA reverse details
ef1a EF1-Glom1R TTACAACCATACCGGCCTTG reverse details
atp6 ATPMF1 CAYTTYGYITTAACATTYG forward details
atp6 ATPMR1 TTTAAWCCRTATTTWKIRAAYCC reverse details
mitssu MSR2 GGCCATGATGACTTGTC reverse details
ef1a CEFR1 CCGTKCAARCCRGAGATGG reverse details
ef1a CEFR2 GRGGGTCGTTCTTGGWGTC reverse details
ef1a EF1a5R GGGTTGWANCCRAYCTTCTT reverse details
ef1a EF1a6R CCACCRATCTTGTARACATCYTG reverse details
ef1a EF1a7R CTTGACGGACACGTTCTTGA reverse details
rpb1 RPBC-F1 GMGMAACGARGAYGAYTTGAC forward details
ef1a Efdf AAGGAYGGNCARACYCGNGARCAYGC forward details
rpb1 RPB1-G2R GTCATYTGDGTDGCDGGYTCDCC reverse details
ef1a EF1-1Fa GCTGGTATCTCCAAGGATG forward details
ef1a EF1-1Ra TCRGTGAARGCCTCAAC forward details
rpb2 R22-3Fa TGGGGWGAYRAAGAAG forward details
rpb2 R22-3Ra GTGTGKCCRTKGKACATG forward details
nucits 5_8S2 ATTCGTTGCGTTCTTCATCG reverse details
nucssu SR8_5R GGGATAGTTGGGGGCATTAG forward details
nuclsu LR11R CATGAAAGTGTGGCCTATCG forward details
rpb1 r1-M13F GTAAAACGACGGCCAG forward details
rpb1 r1-M13R CAGGAAACAGCTATGAC reverse details
rpb1 RPB1-FF CAYGCDATGGGDGGDMGDGARGG forward details
rpb1 RPB1-2F AARGGNAARGARGGNCG forward details
rpb1 RPB1-3F ARGATGATYTRACNYACAARCT forward details
rpb1 RPB1-3R CCATVCCRTCYTCNCCRTA reverse details
rpb1 RPB1-4R AARTCNACNCGYTTNCCCAT reverse details
rpb1 RPB1-BD1F ACNRTTGAAATGACACCMGA forward details
rpb1 RPB1-BD1R GGCCCAYTTGTCWGTAGA reverse details
rpb2 R2iF GATGCYGARGAAGARGAGAC forward details
rpb2 R2iR TGGGCAATTGTCATACG reverse details
rpb1 RPB1-6F TNCAYAARATGAGTATGATGGG forward details
rpb1 RPB1-5R GWRTCYTGNACRATNCCCAT reverse details
rpb1 RPB1-CH1R CTCCAGMGYYTGCKTCTCAAC reverse details
rpb1 RPB1-2R CCYTCNCMWCCVCCCATDGCRTGGAA reverse details
nucssu Endo18S-1F GAGGTGAAATTCTTGGATTTATGA forward details
rpb2 b10-9R GTRAASGGYGTGGCRTCYCC forward details
rpb2 r2-M13F GTAAAACGACGGCCAG forward details
rpb2 r2-M13R CAGGAAACAGCTATGAC reverse details
rpb2 RPB2-1R CRAYNGTCATWCGVGANGGRAT reverse details
rpb2 RPB2-2F GNYTNGAYYTNGCNGGNCC forward details
rpb1 INT2-F TTMBTCTRCTCGTTTYGCAC forward details
rpb1 INT2_1-F GCTGAACGAGSAGTGC forward details
rpb2 bRPB2 6_3F GTYATYGGTGTNTGGATGGG forward details
rpb2 bRPB2 8_2R CTNCGGAANAGRCCRCGRTC reverse details
rpb1 r1 M13-F GTAAAACGACGGCCAGTGAA forward details
rpb1 r1 M13-R CAGGAAACAGCTATGACCAT reverse details
rpb1 RPB1-7F CNCGNCCNGANTGGATGAT forward details
rpb2 RPB2-8_5R GARTCYTCYTGRTTRTANCC reverse details
rpb2 RPB2-5_5F CTNGCNACNGGNAACTGGGG forward details
rpb2 RPB2-8R AGNGGYTTYTGNGGRTAR reverse details
rpb2 RPB2-6_5F ARACNCCCGARGGNCARGC forward details
rpb2 RPB2-5_5R TGNTCNCCCCAGTTNCCNGT reverse details
rpb2 RPB2-6_1R TCNCGNCCNATNGGNGTRTT reverse details
rpb2 RPB2-9R GTWCCYTTYTGNCCRTGNCG reverse details
rpb2 RPB2-10R ATCTTGTCRTCNACCATRTGCTT reverse details
rpb2 mlRPB2 6R CGAGATACATGACATAAGGGC reverse details
rpb2 mlR2 6_9F CAAAGCTGGTACACACGCCC forward details
nucssu PNS1 CCAAGCTTGAATTCGTAGTCATATGCTTGTC forward details
nucssu NS19bc GTTTCTCAGGCTCCCTCTCCGG reverse details
nucssu NS19b CCGGAGAGGGAGCCTGAGAAAC forward details
nucssu NS41 CCCGTGTTGAGTCAAATTA reverse details
nucssu NS51 GGGGGAGTATGGTCGCAAGGC forward details
rpb2 bR2-10_9R GTRAASGGYGTGGCRTCYCC reverse details
rpb2 bRPB2-3_1F ATYGCYCAAGARMGNATGGC forward details
rpb2 bRPB2-7R GAYTGRTTRTGRTCRGGGAAVGG reverse details
rpb2 bRPB2-7_1R CCCATRGCYTGYTTMCCCATDGC reverse details
rpb2 RPB2-10F GCCACKCCSTTCACSGACGTGAC forward details
rpb2 RPB2-M13F GTAAAACGACGGCCAGTGAA forward details
rpb2 RPB2-M13R CAGGAAACAGCTATGACCAT reverse details
ef1a EF-1953R CCRGCRACRGTRTGTCTCAT reverse details
ef1a EfcF ATYGCYGCNGGTACYGGYGARTTCGA forward details
ef1a EF1aZ-1R ACATCWCCGACACCCTTGATCTTG reverse details
nucssu AU2 TTTCGATGGTAGGATAGDGG forward details
nucssu AU4 RTCTCACTAAGCCATTC reverse details
rpb2 bRPB2 6_9F TGGACNCAYTGYGARATYCAYCC forward details
rpb2 bRPB2 7_1F TCNCCNCGHAAYACNTAYCAR forward details
rpb2 bRPB2 6F TGGGGYATGGTNTGYCCYGC forward details
nucssu Z31G ATGATTAATAGGGACAGTTGG forward details
atp6 atp6-1 ATTAATTSWCCWTTAGAWCAATT forward details
atp6 atp6-2 TAATTCTANWGCATCTTTAATRTA reverse details
atp6 atp6-3 TCTCCTTTAGAACAATTTGA forward details
atp6 atp6-4 AAGTACGAAWACWTGWGMTTG reverse details
ef1a EF-2212R CCRACRGCRACRGTYTGTCTCAT reverse details
mitssu mtSSUc-1F ATTRRCWTAACACATGCT forward details
mitssu mtSSUc-1R TTTGCTCCCCACACTTT reverse details
mitssu mtSSUc-2R GTRGACTAMTSRGGTATCTAATC reverse details
mitssu mtSSUc-2F GCWGCAGTGRGGAATNTTGGRCAAT forward details
rpb1 RPB1-G1r TGRAADGTRTTDAGDGTCATYTG reverse details
rpb1 INT2_1-R GCACTSCTCGYTCAGC reverse details
ef1a EF-iR GCRTGYTCNCGRGTYTGNCCRTC reverse details
rpb2 b7R2 ACYTGRTTRTGRTCNGGRAANGG reverse details
rpb2 b6R2 GGRCANACCATNCCCCARTG reverse details
rpb2 U6-9F ACGCATTGYGARATYCAYCC forward details
rpb2 11R1 TGGATYTTGTCRTCCACCAT reverse details
rpb2 b10F GTCAYGGWCAAAARGGWAC forward details
nucssu SR6_1 TGTTACGACTTTTASTTCCTCT reverse details
nucssu NS8_1 CCGCAGGTTCACCTACG reverse details
rpb2 b6R1 ACCATWCCCCARTGNTGRTTGTG reverse details
rpb2 bRPB2 10F GTCAYGGWCAAAARGGWAC forward details
rpb1 VH-R ATGACCCATCATRGAYTCCT reverse details
rpb1 VH-F CAYAAGGARTCYATGATGG forward details
rpb1 VH/6FRev ATGACCCATCATRGAYTCCTTRTG reverse details
rpb1 VH/6F CAYAAGGARTCYATGATGGGTCAT forward details
rpb1 VHseq1 CGYTGRATGTANCCRGTYTC reverse details
rpb1 VHseq2 CGYTRRATRTANCCNGTYTC reverse details
rpb1 C-2f TAYGCNMGNCCNGANTGGATGAT forward details
rpb2 R2-4Fa GCNACNGGNAAYTGGGG forward details
rpb1 R1-DDR TCRAARTCNGCRTTRTANGG reverse details
rpb1 R1-FFR GTYTCNGCNGTYTTNACNGCNG reverse details
atp6 atp6-M13F GTAAAACGACGGCCAG forward details
atp6 atp6-M13R CAGGAAACAGCTATGAC reverse details
nucits M13F GTTTTCCCAGTCACGAC forward details
nucits M13R CAGGAAACAGCTATGAC reverse details
rpb2 fRPB2-d7R CCCATWGCYTGCTTMCCCAT forward details
rpb2 fRPB2-8R CGTTRYCATRGTYTCCATRC reverse details